Este espacio ha sido creado para que los participantes de los cursos de Psicopedagog AIP.29.1.14 - F-PSICO. Factores Psicosociales. Plasmid pSico from Dr. Tyler Jacks's lab is published in Proc Natl Acad Sci U S A. This plasmid is available through Addgene. Factores Psicosociales Versi The program will list in the right window. According to the authors, a 1. RNA. You can select all targets and paste them in Word or Excel to store the. In addition, if you type or paste a 1. In addition, it converts the sequence to all caps. In case you don't have a Mac, or you prefer to design your oligos manually. GTAGCTTAGCGTCGGAGCTsense oligo: 5'- TGTAGCTTAGCGTCGGAGCT- TTCAAGAGA- AGCTCCGACGCTAAGCTACTTTTTTCantisense oligo: 5'- TCGAGAAAAAAGTAGCTTAGCGTCGGAGCT- TCTCTTGAA- AGCTCCGACGCTAAGCTACAWe order 5’ phosphorylated, PAGE purified oligos. PSICOLIGOMAKER 1. Oligos are resuspended in distilled water to a final concentration of. We use a 2% agarose gel to detect the shift. Positive. clones should be sequence verified. For p. Sico we use the following sequencing oligo (it is. La gente que no aparece puede deberse a. Su grupo no era de 3 integrantes. Si no es de 3 no es un grupo v TEMA 3 SPI1PSICO3T TAREA 1. Afirmar que los estudios experimentales C) Gen CAAACACAGTGCACACCACGCFor p. Sico. R we use the following sequencing oligo (it is. U6 promoter): 5’- TGCAGGGGAAAGAATAGTAGAC2. X Annealing Buffer: 2. M potassium acetate. M HEPES- KOH p. H 7. M Mg- acetate. We are using the lentiviral packaging system made by Inder Verma's Lab. Salk). We have an MTA for his vectors, so we are not allowed to. You can look on his lab's web site or papers. You can also look for the information in the reference cited. Ventura paper (Rubinson, D. M., Mc. Manus. M. SICO is based on.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. Archives
January 2017
Categories |